Recombinant HSV Vectors Can Be Easily Produced To High Titer And Purity Without Wild-type (wt) Contaminants

Recombinant HSV vectors can be easily produced to high titer and purity without wild-type (wt) contaminants. The latent behavior of the virus may be exploited for stable long-term expression of therapeutic transgenes in neurons. Purification and concentration of recombinant viral vectors present a number of challenges associated with the unique characteristics of virions including particle size and shape, physico-chemical properties, stability and binding to their receptors. Successful production of such cell lines has not been reported to date. RAAV vectors with a genome length equal to the wild type will band at a density of 1. Second, it is difficult to separate virus particles from high molecular weight contaminants that coelute with the virus in the excluding volume of the column. Vector BioLabs is recombinant adenovirus company providing robust gene delivery system. Although the method using wild-type adenovirus-inducible AAV producer cell lines can be easily scaled up in cultures and produce AAV vectors with very high titers, it is very challenging to completely get rid of the adenovirus from AAV product, and contamination of wild-type adenovirus is highly undesirable in view of vector safety and specificity.

Oncolytic virus therapy using genetically engineered herpes simplex viruses 2Recombinant AAV (rAAV) vectors are being proposed as a gene transfer vehicle for an array of human diseases. Therefore, the ability to produce high-titer rAAV is critical for clinical applications and has historically been the primary impediment to the widespread use of this vector system. Also provided are methods for preparing high-titer rAAV vector compositions suitable for gene therapy and the delivery of exogenous polynucleotides to selected host cells. A recombinant AAV virus produced by the method of claim 43. Finally, wt AAV was not detected in any of the HSV-1 amplicon produced rAAV preparations. The virus does not encode a polymerase relying instead on cellular polymerase activities to replicate its DNA 5. The circular episomes can also evolve into high-molecular-weight concatamers in a time-dependent manner 79. Right panel: According to the same replication model, a rAAV genome with roughly half the size of the wild-type AAV DNA and with one trs mutated, generates DD replicative intermediates with an inverted repeat configuration containing wild-type ITRs at the extremities and mutated ITRs at the axis of symmetry.

Ad vectors have a good safety profile and can be produced at high titers under GMP conditions, do not integrate, can transduce dividing and non-dividing cells and present high in vivo transduction efficiency. Moreover, they can be easily produced to high titer and purity without wild type contaminants. HSV-1 oncolytic viruses have been studied to treat pancreatic cancer. Decisions regarding the choice of a gene vector can be complex (see Design Considerations for Gene Vectors under Manufacturing of Gene Therapy Products). The quality of raw materials used in the production of a gene therapy product can affect the safety, potency, and purity of the product. The WCB is produced or derived by expanding one or more vials of the MCB. For viral vectors, the humoral immune system cannot readily distinguish between wild-type viral infections and recombinant viral vectors because the humoral response is directed against proteins in the viral envelope or capsid. These include the apathogenicity of the underlying wildtype viruses and the highly advanced methodologies for production of high-titer, high-purity and clinical-grade recombinant vectors2. These include the apathogenicity of the underlying wildtype viruses and the highly advanced methodologies for production of high-titer, high-purity and clinical-grade recombinant vectors2. A further particular advantage of the AAV system over other viruses is the availability of a wealth of naturally occurring serotypes which differ in essential properties yet can all be easily engineered as vectors using a common protocol1,2. The cell biology of HSV-1 latency remains poorly understood, in part due to the lack of methods to detect HSV-1 genomes in situ in animal models.

Recent Advances In Recombinant Adeno-associated Virus Vector Production

Expression of HSV-TK in VNP20009 has demonstrated its selective accumulation in subcutaneously implanted murine colon 38 tumors 32 3First, recombinant adeno-associated virus (rAAV) vectors can transduce terminally differentiated and non-dividing cells. 10.sup.5 more rAAV can easily be produced with the novel method described herein. Using primers specific for the Ad region flanking the rep genes, the full-length wildtype rep genes amplifies a 2.2 Kb fragment, while a deletion within the rep genes occurs following multiple passages through 293 cells. Hybrid AdAAVs are capable of delivering all of the genetic components for high titer rAAV production, as well as minimizing contamination of Ad helper virus. Based on the nature of the viral genome, these gene therapy vectors can be divided into RNA and DNA viral vectors.

Cancers

Development And Optimization Of Herpes Simplex Virus Vectors For Multiple Long-Term Gene Delivery To The Peripheral Nervous System

Development and Optimization of Herpes Simplex Virus Vectors for Multiple Long-Term Gene Delivery to the Peripheral Nervous System. Herpes simplex virus (HSV) has often been suggested as a suitable vector for gene delivery to the peripheral nervous system as it naturally infects sensory nerve terminals before retrograde transport to the cell body in the spinal ganglia where latency. Several RNA viruses have also been developed for gene delivery, including a poliovirus replicon system for motor neurons. Herpes simplex virus (HSV) is an attractive candidate for use as a viral vector to express foreign genes. There has been some success on that front in peripheral neurons; however, long-term expression in the central nervous system has not been as good.

Development and Optimization of Herpes Simplex Virus Vectors for Multiple Long-Term Gene Delivery to the Peripheral Nervous System 2Virus vectors for gene delivery to the nervous system on ResearchGate, the professional network for scientists. Many developments in vectors should be occurring over the next few years that should increase the potential of these vectors for therapeutic gene delivery. Development and Optimization of Herpes Simplex Virus Vectors for Multiple Long-Term Gene Delivery to the Peripheral Nervous System. A number of studies have demonstrated transduction of DRG neurons using herpes simplex virus, adenovirus and more recently, adeno-associated virus (AAV). 6 as a gene transfer tool to target cellular mechanisms involved in the generation and development of chronic pain in mice. Palmer JA, Branston RH, Lilley CE, Robinson MJ, Groutsi F, Smith J, Latchman DS, Coffin RS: Development and optimization of herpes simplex virus vectors for multiple long-term gene delivery to the peripheral nervous system. Reduced immune responses after vaccination with a recombinant herpes simplex virus type 1 vector in the presence of antiviral immunity. 4e F4 ), the differentially pre-infected mice were only able to develop weak CTL responses KOS, 5; HSV-F, 55; T0-GFP, 13 (Fig. Development and optimization of herpes simplex virus vectors for multiple long-term gene delivery to the peripheral nervous system.

Our results support the utility of HSV vectors for gene silencing in peripheral neurons and the potential application of this technology to the study of nociceptive processes and in pain gene target validation studies. Lentiviruses, adenoassociated viruses and more recently, herpes simplex virus have been engineered to deliver short-hairpin RNA (shRNA) to parts of the nervous system (15 20,21). Development and optimization of herpes simplex virus vectors for multiple long-term gene delivery to the peripheral nervous system. Several issues must be considered in choosing a gene transfer vector for a spe- cific application. Figure 1 HSV vector-mediated gene delivery to the nervous system can be accom-. This paper reviews the major HSV-1 vector systems and analyses the common elements which These properties have yet to be determined for different viral vectors for human applications and gene delivery to different tissues by different methods of administration in animal models will need to be explored to translate this to clinical trials.

Virus Vectors For Gene Delivery To The Nervous System

Adeno-associated virus (AAV)-mediated gene delivery has emerged as an effective and safe tool for both preclinical and clinical studies of neurological disorders. Adeno-associated virus is a non-pathogenic dependovirus from the parvoviridae family requiring helper functions from other viruses, such as adenovirus or herpes simplex virus, to fulfill its life cycle (Dayton et al. To overcome these limitations, several methods have been developed to improve brain transduction after systemic injection (Figure 1). Samples were washed four times (10 min each) and developed with diaminobenzidine (Sigma, St. Louis, MO). Coffin RS: Development and optimization of herpes simplex virus vectors for multiple long-term gene delivery to the peripheral nervous system.

Efficient Delivery Of Rna Interference To Peripheral Neurons In Vivo Using Herpes Simplex Virus

Develop Fully Retargeted Herpes Simplex Virus (HSV) Vectors For Oncolytic Virotherapy,and

Oncolytic herpes simplex virus type 1 (HSV-1) vectors are emerging as an effective and powerful therapeutic approach for cancer. Hence, the focus for further development of HSV-1 vectors was directed at engineering viruses with mutations in other genes affecting virulence. 40 Moreover, because tumors are typically heterogenous genetically and therapy selects for resistant phenotypes, no single agent is usually universally applicable or completely effective. B-myb promoter retargeting of herpes simplex virus gamma 34.5 gene mediated virulence toward tumor and cycling cells J Virol 1999 73: 7556 7564 PubMed ISI ChemPort. Oncolytic herpes simplex virus (HSV) vectors have attracted increasing attention as novel anti-cancer agents. Interestingly, the retargeted virus developed larger plaques on some of the human tumor lines tested than the control virus bearing wild-type gD. The human pathogen herpes simplex virus (HSV) has proven particularly amenable for use in oncolytic virotherapy. This review focuses on the development of HSV as an oncolytic virus and where the field is likely to head in the future. While creating another retargeting mutant, with urokinase plasminogen inserted into gD instead of IL-13, it was discovered that an 159 amino acid region in gD was dispensable for its function. Oncolytic herpes simplex virus vector with enhanced MHC class I presentation and tumor cell killing.

Develop fully retargeted herpes simplex virus (HSV) vectors for oncolytic virotherapy,and 2Oncolytic viruses can kill infected cancer cells in many different ways, ranging from direct virus-mediated cytotoxicity through a variety of cytotoxic immune effector mechanisms. HPMA-cloaked adenovirus vectors are also protected from neutralizing antibodies and have a prolonged circulatory half-life44. This may be a consequence of the safety concerns being more difficult to address for fully retargeted viruses that stringently target a single type of tumor. Notably, two or three separated vectors have to be constructed (9, 16, 43, 54). FULL TEXT Abstract: Viruses have long been considered potential anticancer treatments. This is meant to illustrate a basic framework for the development of a novel therapy meant to exploit the viral life cycle for the killing of cancer. Over the past two decades, herpes simplex virus 1 (HSV-1) oncolytic agents have transitioned from an area of theoretical interest to a major focus in the search for novel cancer therapies. Oncolytic virotherapy with an HSV amplicon vector expressing granulocyte-macrophage colony-stimulating factor using the replication-competent HSV type 1 mutant HF10 as a helper virus.

Rescue and propagation of fully retargeted oncolytic measles viruses. Herpes simplex virus type 1 is highly infectious, so HSV-1 vectors are efficient vehicles for the delivery of exogenous genetic materials to cells. The inherent cytotoxicity of this virus, if harnessed and made to be selective by genetic manipulations, makes this virus a good candidate for developing viral oncolytic approach. Full-text Article Nov 2014 Journal of Cancer Therapy. A recombinant oncolytic Herpes Simplex Virus (oHSV), comprising:. This new vector design should provide a safer and more effective vector platform and can be further developed for application to patient tumors. EGFR-retargeted miR-124-sensitive HSV vector treatment of a nude mouse model of human glioblastoma. 0033 Experimental Design: We report an oHSV engineered to infect and replicate selectively in tumor cells by fully retargeting the infection through the EGFR and by blocking vector replication in normal neurons through the introduction of multiple copies of the sequence recognized by the neuronal-specific miR-124 into the 3’UTR of the essential ICP4 immediate early HSV gene.

Oncolytic Virotherapy

Develop fully retargeted herpes simplex virus (HSV) vectors for oncolytic virotherapy,and 3Part II: potential clinical application of oncolytic herpes simplex virus-1 in children. VEGF Blockade Enables Oncolytic Cancer Virotherapy in Part by Modulating Intratumoral Myeloid Cells. Efficacy of HER2 retargeted herpes simplex virus as therapy for high-grade glioma in immunocompetent mice. Development of a rapid method to generate multiple oncolytic HSV vectors and their in vivo evaluation using syngeneic mouse tumor models. Another field of active study involves the use of herpes simplex virus for tumor therapy (reviewed in 17, 18 ). Retargeting of HSV could be achieved by the insertion of ligands and scFvs into the gC and/or the gD protein, with subsequent increased infectivity of target cells expressing the appropriate virus receptor. Due to the broad cell tropism of wild-type AAV, retargeting in combination with ablation of its natural tropism will remain crucial to develop this virus into a safe oncolytic vector. These otherwise highly species-specific recombinant viruses were able to cross species barriers; fMHV had acquired feline cell tropism but completely lost its murine cell tropism while the opposite was true for mFIPV. Keywords: HSV, viral vectors, oncolytic vectors, gene therapy, neurodegenerative disorders, cancer, targeting, vaccines. Herpes simplex virus (HSV) is an enveloped, double-stranded (ds) DNA virus 1. To follow HSV-1 C-gal-Luc strain replication in the tumour mass the virus was inoculated into the experimental tumour, developed on the right flank of athymic mice, and localization and intensity of luciferase expression was monitored by in vivo bioluminescence imaging. Fiume G. Construction of a fully retargeted herpes. Oncolytic herpes simplex virus (oHSV) has been investigated in clinical trials for patients with the malignant brain tumor glioblastoma for more than a decade. Thus, there is an urgent need to develop novel, effective therapies for this devastating malignancy. (1991), which opened the door to applying virotherapy for GBM. Thus, tropism manipulation through retargeting fully replication competent HSV to GBM-associated receptors might provide an avenue for increased infectivity and specificity for the target cell as well as efficacy, without compromising safety. Several properties make herpes simplex viruses (HSVs) attractive candidate oncolytic agents. 5 HSVs, whereas low MEK-high PKR tumors do not support replication of the HSV recombinants, so they are not suitable targets for HSV-based virotherapy. The natural neurotropism of herpesviruses prompted the development of various oncolytic viruses for the treatment of glioblastoma 54-56.

Oncolytic Virotherapy Of Glioma: What Does It Need To Make It Work

Many variants of herpes simplex virus have been considered for viral therapy of cancer; the early development of these was thoroughly reviewed in the journal Cancer Gene Therapy in 2002. HSV1716 is a first generation oncolytic virus developed by The Institute of Virology, Glasgow, UK, and subsequently by Virttu Biologics (formerly Crusade Laboratories, a spin-out from The Institute of Virology), to selectively destroy cancer cells. It is based on the herpes simplex virus (HSV-1). G207 was constructed as a second-generation vector from HSV-1 laboratory strain F, with ICP34. Further research aiming to enhance anti-tumor efficacy and to improve selectivity of infection and replication, will eventually lead to full realization of the therapeutic potential of (replicating) viral vector systems for gastric cancer. Consequently, targeted viral vectors for enhanced delivery of transgenes to tumor cells and replicative viral systems designed to replicate selectivelyin malignant tissue were developed. Various viruses mainly responsible for the development of oral cancers with their mechanisms of tumorigenesis have been described. Remission of disseminated cancer after systemic oncolytic virotherapy. Oncolytic herpes simplex virus vectors and chemotherapy: Are combinatorial strategies more effective for cancer? Future Oncol 2010;6:619-34. Todo T. Active immunotherapy: Oncolytic virus therapy using HSV-1. Herpes simplex virus (HSV) is a ubiquitous human pathogen that causes a wide spectrum of disease, ranging from asymptomatic viral shedding to lethal encephalitis and disseminated disease 1,2. Herpes Simplex Viruses Mutant in 34.5 Are Used as Oncolytic Vectors.

Keywords: HSV, Viral Vectors, Oncolytic Vectors, Gene Therapy, Neurodegenerative Disorders, Cancer, Targeting, Vaccines

Selective oncolysis in combination with modulation of the immune response mediated by replication-conditional HSV-1 vectors appears to be a highly promising approach in the battle against malignant glioma. PNS and CNS for the treatment of various neurodegenerative disorders or chronic pain. Replication-defective herpes simplex virus vectors for gene transfer in vivo. However, numerous delivery challenges must be overcome to extend this success to many diseases; these challenges include developing techniques to evade preexisting immunity, to ensure more efficient transduction of therapeutically relevant cell types, to target delivery, and to ensure genomic maintenance. Fortunately, vector-engineering efforts are demonstrating promise in the development of next-generation gene therapy vectors that can overcome these barriers. Key words:viral vectors – HSV-1-based amplicons – applications – technological improvements. Viral-derived vectors are the most promising gene transfer tools due to the fact that viruses are naturally occurring molecular devices that have evolved to ensure targeted gene delivery and efficient expression in most cell types. Recombinant attenuated viruses are replication-competent HSV-1 vectors carrying mutations that restrict spread and lytic viral replication to cancer cells without causing major toxicity to the healthy tissues. A few studies have addressed the use of amplicons for gene therapy of neurodegenerative disorders, such as treatment of experimental models of Parkinson’s disease, or inherited genetic diseases affecting the nervous system such as ataxia-telangiectasia and Friedreich’s ataxia.

Keywords: HSV, viral vectors, oncolytic vectors, gene therapy, neurodegenerative disorders, cancer, targeting, vaccines 2Keywords: epigenetics, glioma, oncolytic virus, HDAC inhibitor, HSV-1, cancer. In contrast to non-replicating viral vectors, OVs still maintain most of their viral genes intact, particularly those that encode genes required for the viral replicative life cycle, viral evasion mechanisms from host defense, and immune surveillance. Inhibitors of zinc-dependent HDACs have shown great potential in the treatment of epigenetic disorders including cancers. Research Keywords: Human tumor virology (KSHV, MCV and digital transcriptome subtraction). Dendritic cell dynamics in viral infections; vector-based vaccines for viral infections. Gene therapy for brain tumors using HSV-based vectors; molecular targeting to tumor cells; molecular mechanisms of tumor cell migration; miRNAs in cancer progression. HSV; VZV; herpes simplex virus; zoster; varicella; viral infection; viral latency; infectious eye disease; pain and post-herpetic neuralgia; neuronal infection. Keywords: Molecular analysis; Radiology and radiologists, research; Review. (disease-resistant crops, biologically derived pesticides, vaccines), among others.

Viral vectors have provided excellent delivery and high expression of heterologous genes. Similarly, helper-free HSV-1 vectors expressing GDNF and BDNF were evaluated in a rat model for Parkinson s disease 7. Further development has included using oncolytic SFV vectors against lung cancer 26 and osteosarcoma 27 in mouse models. Partridge WM (2004) Intravenous, non-viral RNAi gene therapy of brain cancer. Helper-dependent herpes simplex virus (HSV) vectors (amplicons) show considerable promise to provide for long-term transduced-gene expression in most cell types. HSV-specific primers were targeted to the UL40 gene (primer 40 ACCATAGCCAATCCATGACC ) and theUL42 gene (primer 42 GTCGTGAGGAAGAACTTGAGG ) and were designed to amplify across the entire UL41 gene. The development of gene-based therapies is currently being pursued in fields as diverse as infectious disease, autoimmune disease, cardiovascular disease, and neurodegenerative disease.

Combining Hdac Inhibitors With Oncolytic Virotherapy For Cancer Therap

Keywords: HSV, viral vectors, oncolytic vectors, gene therapy, neurodegenerative disorders, cancer, targeting, vaccines 3

Alphavirus Vectors For Therapy Of Neurological Open Access

HSV1-based Vectors Were Initially Examined As Potential Vehicles For Gene Transfer Into The Central Nervous System

HSV1-based vectors were initially examined as potential vehicles for gene transfer into the central nervous system 1

Only later were they considered suitable gene transfer vehicles, especially for use in the central nervous system (CNS). HSV-1 Amplicon Vector-Mediated Gene Transfer into Cells of the Nervous System. HSV1-based vectors were initially examined as potential vehicles for gene transfer into the central nervous system. Unwanted cytopathic effects resulting from viral infection plagued these early experiments (11, 12). In recent years, the development of powerful viral gene transfer techniques has greatly facilitated the study of gene function. Researchers were quick to see the potential of such systems and started to develop optimised vectors. The studies so far have shown that AAV-based vectors, particularly the AAV2 serotype, are safe and efficient tools for gene transfer (further information on AAV vectors was given by Professor Michael Linden during this meeting and is also published in this special edition of Journal of Cell biology and Toxicology). A model system for in vivo gene transfer into the central nervous system using an adenoviral vector.

HSV1-based vectors were initially examined as potential vehicles for gene transfer into the central nervous system 2Herpes simplex virus, HSV-1, cancer, oncolytic virus, clinical, gene therapy. Fusion of the viral envelope with the cell membrane rapidly follows the initial attachment. Herpes simplex virus-based vectors for cancer treatment exist in three forms: amplicon, replication-defective vectors and replication-conditional viruses. Gene Transfer and Expression in Mammalian Cells. BAC, bacterial artificial chromosome;; CNS, central nervous system; Engineering viral entry into the cell. Herpes simplex virus type 1 (HSV-1) is a naturally neurotropic DNA virus proficient in establishing latent infection within neurons, but moreover possesses the ability to infect a wide range of cell/tissue types. This finding combined with the inherent ability of this virus to gain entry into neurons initially led to the development of HSV-based gene transfer vectors for diseases of the central nervous system (CNS). Recombinant vectors are also attractive gene transfer vehicles for CNS disorders because they can be propagated to relatively high titers (108 109 PFU/ml).

However, the first adenoviral and Herpes gene transfer systems were highly effective at transducing neurons and could hence be used to study gene function in whole animal systems without developmental compensatory effects (Hermens and Verhaagen 1998). The HSV vector systems therefore mimic this latent state, producing a highly infectious, efficient vehicle for the delivery of exogenous genetic material to cells. Studies have also examined the transduction and expression characteristics of these serotypes in brain (Cearley et al. A model system for in vivo gene transfer into the central nervous system using an adenoviral vector. Transfer and expression of gene sequences into central nervous system cells using herpes simplex virus mutants with deletions in genes for viral replication. Herpes simplex viruses possess several properties that render them attractive candidates as delivery vehicles to bring foreign genes into cells of the peripheral and central nervous systems. First, following inoculation of HSV-1 in the periphery, a burst of virus production ascends the neuraxis, initially in the sensory or motor neurons innervating the site of inoculation, then in the spinal cord, brain stem, cerebellum, and cerebral cortex (Koprowski, H. A prerequisite for using recombinant HSV vectors for therapeutic gene delivery to humans is the development of methods for large-scale manufacture of HSV vectors. Effect of genetic background and culture conditions on the production of herpesvirus-based gene therapy vectors. Herpes simplex virus type-1 (HSV-1) represents a unique vehicle for the introduction of foreign DNA to cells of a variety of tissues. Our work uses replication-defective genomic herpes simplex virus type-1 (HSV-1)-based vectors to transfer therapeutic genes into cells of the central nervous system and other tissues.

Cancer Gene Therapy

Gene transfer using herpes virus vectors as a tool for neuroprotection, US Patent No: 5661033 (1997). Ho did her PhD work in HSV pathogenesis and postdoctoral research in CNS gene therapy with viral vectors. The primary hypothesis is that over the initial two weeks of anti-fungal therapy, fungal biomarkers from participants with invasive aspergillosis (IA) will be lower for those with a successful clinical outcome compared to those with a failed clinical outcome. Herpes simplex virus type 1 (HSV-1) is a promising vector for gene therapy applications, particularly at peripheral nerves, the natural site of virus latency. The introduction of a cobalt-specific recognition element into the virus envelope may provide a suitable target for cobalt-dependent purification. HSV-1-based vectors exhibit the advantages of a broad host cell range, a large transgene packaging capacity, and potentially lifelong transgene expression in neurons mediated by components of the natural virus latency promoter system (19, 20). 1 and 3) were separated by using the NuPAGE system and were transferred to a polyvinylidene difluoride membrane. Because CNS cultures contain a mixture of glia and neurons, in a second set of experiments we used more selective cultures enriched in glia or neurons to infect with MC. This finding was based both on fluorescent microscopy and the use of video-enhanced differential interference contrast (DIC) microscopy used to detect nonfluorescent cells. In both sets of experiments, 3T3 cells were examined 18 hr after their initial incubation with brain culture supernatant. The experiments with mouse brain cells suggested that mCMV might be a potentially useful vector for gene transfer into mouse brain cells. Current gene delivery vehicles, namely vectors, are categorized into two classes: DNA (non-viral) vectors and viral vectors (Figure 1). Genomic integration ensures the stability of transgene and persistent transgene expression in daughter cells following genome replication and cell division, but its randomness results in the risk of insertional mutagenesis by potentially disrupting tumor suppressor genes or activating oncogenes (Hacein-Bey-Abina et al. Ex Vivo Gene Transfer and Cell-based Gene Therapy.

Using Viral Vectors As Gene Transfer Tools (cell Biology And Toxicology Special Issue: Etcs-uk 1 Day Meeting On Genetic Manipulation Of Cells)

Summary HSV Based Vectors For Vaccination

Summary HSV Based Vectors for Vaccination 1

This review focuses on replication-defective and replication-competent HSV-based vectors. When constructing a recombinant virus for use as an attenuated vaccine or vector, it is possible to over-attenuate the virus, which could possibly negate its value. Summary HSV Based Vectors for Vaccination. Vectors based on HSV type 1 are currently a) amplicon vectors, b) replication-defective viruses and c) genetically engineered replication-competent viruses with restricted host range. HSV-1-derived recombinant and amplicon vectors for preventive or therapeutic gene transfer: an overview. A Lentiviral Vector-Based, Herpes Simplex Virus 1 (HSV-1) Glycoprotein B Vaccine Affords Cross-Protection against HSV-1 and HSV-2 Genital Infections. Genomic maps of vector, packaging, and Env plasmids used to generate vLAW-gB1 and analysis of gB1 expression in vitro.

Summary HSV Based Vectors for Vaccination 2Many replication-incompetent HSV-1-based vectors have also been used either as potential anti-herpes vaccines, as well as vaccine vectors for other pathogens in murine and simian models. Herpes simplex virus, replication-incompetent viral vectors, neuronal gene delivery, cancer gene therapy, vaccination. Delivery using herpes simplex virus: an overview. Over the last years, herpes simplex virus (HSV)-based vectors have evolved as an attractive gene transfer system for a variety of applications reaching beyond gene therapy of nervous system diseases for which these vectors were originally developed. With regard to primary human cells, we focused our analysis on ALL, the single most common childhood malignancy. DNA vaccination is a technique for protecting an animal against disease by injecting it with genetically engineered DNA so cells directly produce an antigen, resulting in a protective immunological response. They altered the DNA of cowpox virus by inserting a gene from other viruses (namely Herpes simplex virus, hepatitis B and influenza). DNA vaccines elicit the best immune response when highly active expression vectors are used. Recombinant alphavirus-based vectors have also been used to improve DNA vaccination efficiency.

HSV as a Vector in Vaccine Development and Gene Therapy. This chapter highlights the current knowledge concerning design, construction and recent applications, as well as the potential and current limitations of the three different classes of HSV-1-based vectors. Replication-defective viruses have served both as vaccines for the virus itself and as a vector for the expression of heterologous antigens. Construction, phenotypic analysis, and immunogenicity of a UL5/UL29 double deletion mutant of herpes simplex virus 2. Based upon human epidemiologic data, the rationale for an HSV vaccine is fourfold. First, exogenous reinfection is exceedingly uncommon in the immune-competent host (6). HSV can also be used as a vector to deliver therapeutic gene products to tumors (refs. 45, 48; for review see ref. 49). Indeed the HSV construct G207 (41) demonstrates an adequate safety profile in both cell culture and animal studies (50) and has proved efficacious in several tumor models in vivo (41 43).

Gene Therapy

Summary HSV Based Vectors for Vaccination 3General Overview. The development of vaccines against viral diseases, such as smallpox, genital herpes, and avian influenza, is a high public health priority. Production and characterization of mammalian virus-like particles from modified vaccinia virus Ankara vectors expressing influenza H5N1 hemagglutinin and neuraminidase. Genetic engineering of a modified herpes simplex virus 1 vaccine vector on ResearchGate, the professional network for scientists. Further analysis of this vector is needed to advance development into clinical trials. Adenovirus vector-based vaccines for human immunodeficiency virus type. 1.

HSV As A Vector In Vaccine Development And Gene Therapy

Interleukin 10 Mediated By Herpes Simplex Virus Vectors Suppresses Neuropathic Pain Induced By Human Immunodeficiency Virus Gp120 In Rats

Interleukin 10 mediated by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120 in rats 1

Neuropathic pain was induced by peripheral HIV coat protein gp120 combined with 2,3 -dideoxycytidine (ddC, one of the nucleoside reverse transcriptase inhibitors (NRTIs)). Finn DP, Leonard BE (eds): Pain in Psychiatric Disorders. Neuropathic pain was induced by peripheral HIV coat protein gp120 combined with 2,3 -dideoxycytidine (ddC, one of the nucleoside reverse transcriptase inhibitors (NRTIs)). The area under the effect-time curves (AUC) in mechanical threshold in rats inoculated with the HSV vectors expressing IL-10, was increased compared with the control vectors, indicating antinociceptive effect of the IL-10 vectors.

Interleukin 10 mediated by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120 in rats 2Interleukin 10 Mediated by Herpes Simplex Virus Vectors Suppresses Neuropathic Pain Induced by Human Immunodeficiency Virus gp120 in Rats. Zheng W, Huang W, Liu S, Levitt RC, Candiotti KA, Lubarsky DA, Hao S. Interleukin 10 mediated by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120 in rats. Anesth Analg 2014 Sep;119(3):693-701Wenwen Zheng, Wan Huang, Shue Liu, Roy C Levitt, Keith A Candiotti, David A Lubarsky, Shuanglin Hao. Burning Eye Syndrome: Do Neuropathic Pain Mechanisms Underlie Chronic Dry Eye? HSV vector-mediated GAD67 suppresses neuropathic pain induced by perineural HIV gp120 in rats through inhibition of ROS and Wnt5a.

(2014) IL-10 mediated by herpes simplex virus vector reduces neuropathic pain induced by HIV gp120 combined with ddC in rats. (2014) Interleukin 10 mediated by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120 in rats. Cytokines as Mediators of Pain-Related Process in Breast Cancer. 67 by Herpes Simplex Virus Vectors Suppresses Neuropathic Pain Induced by Human Immunodeficiency Virus gp120 Combined with ddC in Rats. ResultsIn the gp120 with ddC-induced neuropathic pain model, GAD67 expression mediated by the HSV vector caused an elevation of mechanical threshold that was apparent on day 3 after vector inoculation.

Interleukin 10 Mediated By Herpes Simplex Virus Vectors Suppresses Neuropathic Pain Induced By Human Immunodeficiency Virus Gp120 In Rats

Interleukin 10 mediated by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120 in rats 3Interleukin 10 Mediated by Herpes Simplex Virus Vectors Suppresses Neuropathic Pain Induced by Human Immunodeficiency Virus gp120 in Rats. HSV-mediated p55TNFSR reduces neuropathic pain induced by HIV gp120 in rats through CXCR4 activity. Suppression of Detrusor-Sphincter Dyssynergia by Herpes Simplex Virus Vector Mediated Gene Delivery of Glutamic Acid Decarboxylase in Spinal Cord Injured Rats. Article from AIDS Weekly September 22, 2014. Data from Veterans Affairs Medical Center Update Knowledge of Herpes Simplex Virus (Interleukin 10 Mediated by Herpes Simplex Virus Vectors Suppresses Neuropathic Pain Induced by Human Immunodeficiency Virus Gp120 in Rats) (Interleukin 10..). Electroacupuncture Relieves Nerve Injury-Induced Pain Hypersensitivity via the Inhibition of Spinal P2X7 Receptor-Positive Microglia. Pain Induced by Human Immunodeficiency Virus gp120 Combined with ddC in Rats. Interleukin 10 Mediated by Herpes Simplex Virus Vectors Suppresses Neuropathic Pain Induced by Human Immunodeficiency Virus gp120 in Rats. 139 Zheng W, et al: Interleukin 10 mediated by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120. Try CXCR-4 (4G10): sc-53534, our highly recommended monoclonal alternative to CXCR-4 (C-20). Also available as AC, HRP, FITC, PE, Alexa Fluor 488 and Alexa Fluor 647 conjugates. Interleukin 10 mediated by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120 in rats. Anesthesia and analgesia. Interleukin 10 Mediated by Herpes Simplex Virus Vectors Suppresses Neuropathic Pain Induced by Human Immunodeficiency Virus gp120 in Rats.

Gene Therapy Of Hiv-neuropathic Pain With Morphine Tolerance

Long-term safety and tolerability of ProSavin, a lentiviral vector-based gene therapy for Parkinson’s disease: a dose escalation, open-label, phase 1/2 trial. 9 Zheng W, Huang W, Liu S, Levitt RC, Candiotti KA, Lubarsky DA, Hao S. Interleukin 10 mediated by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120 in rats. Results: Neuropathic pain was induced by peripheral HIV coat protein gp120 combined with 2′,3′-dideoxycytidine (ddC, one of the nucleoside reverse transcriptase inhibitors (NRTIs)). Rats with neuropathic pain were inoculated with QHIL10 or QOZHG 1 week post gp1 20 application with ddC. HSV-mediated expression of interleukin-4 in dorsal root ganglion neurons reduces neuropathic painShuanglin HaoDepartment of Neurology, University of Michigan Health System, 1500 E, Medical Center Drive, Room 1914 TC, Ann Arbor, Michigan 48109 0316, USAMol Pain 2:6. QHGAD67 inoculation also suppressed induction of c-Fos and phosphorylated extracellular signal-regulated kinase 1 and 2 in the spinal cord. IL-1 and TNF antagonists each prevented gp120-induced pain changes. Spinal immune activation was induced by intrathecal administration of HIV-1 gp120, a procedure that we have shown previously to produce both thermal hyperalgesia and mechanical allodynia (Milligan et al.

HIV-1 induction of such cytokines as interleukin 1 (IL 1) and tumor necrosis factor-alpha (TNF alpha) may lead to an autocrine feedback loop involving further productive virus replication and induction of other cytokines such as interleukin 6 (IL 6) and granulocyte-macrophage colony-stimulating factor (GMCSF). Interleukin 10 mediated by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120 in rats. Wenwen Zheng, Wan Huang, Shue Liu, Roy C Levitt, Keith A Candiotti, David A Lubarsky, and Shuanglin Hao.

A Number Of Different HSV-1-based Nonreplicative Vectors For Specific Gene Therapy Applications Have Been Developed So Far

A number of different HSV-1-based nonreplicative vectors for specific gene therapy applications have been developed so far. They have been tested in different gene therapy animal models of neuropathies (Parkinson’s disease, chronic pain, spinal cord injury pain) and lysosomal storage disorders. A large number of genes have been tested for their therapeutic efficacy against pancreatic tumors. Suicide or prodrug-converting cancer gene therapy is based on the transfer of an enzyme able to transform a prodrug into a toxic metabolite, resulting in cell death. HSV-1 vectors are characterized by high efficiency of transduction of several different cell types, both dividing and non-dividing 60. Today, adenoviral vectors are used in suicide gene therapy, in gene-based immunotherapy, in gene replacement strategies, and in approaches that combine gene therapy with chemotherapy. Yet another approach to the production of patient-specific vaccines involves transducing autologous tumor cells so that they secrete GM-CSF. However, the mouse systems in which replication-incompetent adenoviral vectors have been studied so far might not be adequate models for replication-competent human adenoviruses.

A number of different HSV-1-based nonreplicative vectors for specific gene therapy applications have been developed so far 2Cancer gene therapy represents one of the most rapidly developing areas in pre-clinical and clinical cancer research. Some progresses have been made in vector targeting with viral (non-replicative and replication-competent), non-viral vectors, and some bacterial modalities as targeted vehicles. Heregulin (HRG) receptors are attractive targets for retroviral vector-based gene delivery since they are often overexpressed on the surfaces of cancer cells. Other strategies are developed to restrict the virus infectivity on particular subsets of human target cells. So, despite evidence showing pronounced region- and layer-specific morphological heterogeneity as well as region-specific actions of astrocytes on neuronal functions, currently available tools have had limited utility for examining functional diversity among astrocytes. Indeed, the development of highly efficient viral vectors for gene transfer in the CNS is providing new systems for localized and controlled gene expression. To date, more than 100 serotypes of AAV have been identified, each of them possessing a specific tropism in the CNS due to the binding of the capsid with specific receptors (Wu et al. Berto E, Bozac A, Marconi P; Development and application of replication-incompetent HSV-1-based vectors. Use of adenoviral vectors as veterinary vaccines.

DNA transposons are primitive genetic elements which have colonized living organisms from plants to bacteria and mammals. Hence, parallel efforts to investigate and develop distinct, but potent, transposon-based vector systems will benefit the broad applications of gene transfer. Since Yant and co-workers in a pioneering study demonstrated in vivo potency of Sleeping Beauty DNA transposon-based gene delivery to the liver of adult mice, continued efforts have been made to understand and further develop DNA transposon elements as gene carriers in mammalian cells and animals. Here, we critically review the efficacy of various gene transfer methods (viral, bacterial, protozoan, and various chemical and physical methods) in transfecting macrophages in vitro, and the results obtained when transfected macrophages are used as gene delivery vehicles. However, as is often the case, attempts to replicate these studies in the more complex in vivo environment have proved difficult with high-level, macrophage-specific transfection proving problematic. Murine leukemia viruses have most often been used for this, but other retroviral vectors have also recently been developed, for example based on human foamy virus, which can give a transfection efficiency of up to 80 11. In addition, a herpes simplex virus-1-derived vector has been used to transfer transgenes to macrophage cell lines 23. To date, various gene therapy strategies have been developed, but first clinical trials reported only limited therapeutic efficacy as a result of limited gene transfer efficiency. First, like for non-replicative viral vector sys-.

Targeting Strategies In Cancer Gene Therapy

Lentiviral vectors have demonstrated efficiency not only as gene delivery vehicles for gene therapy applications but also as vaccination tools. However, no clear-cut immune correlates of protection have been described thus far, and yet several viral vectors shown to elicit specific SIV CD8+ T-cell responses have subsequently failed to control viremia in SIV/macaques models (reviewed by Schoenly and Weiner 51 ). HIV-1 cis-active elements used to produce nonreplicative lentiviral vector particles encoding SIVmac239 GAG is shown. Now, virus therapies are being exploited for many tumor entities, including gliomas, and can be further subdivided into 2 categories: (i) replication-deficient viral vectors, used as delivery vehicles for therapeutic genes with antitumor activities, such as local activation of chemotherapeutic prodrugs or recruitment and activation of immune cells by cytokines12; and (ii) replication-competent oncolytic viruses (OVs) that specifically infect and replicate in cancer cells, destroy their tumor cell hosts in the course of progeny particle release, and spread throughout the tumor. Oncolytic viruses have been developed for various types of cancer, with the first-in-human approval of the oncolytic adenovirus H101 for head and neck cancer in China46 and with an advanced efficacy trial of i. HSV-1-Based Vectors for Gene Therapy of Neurological Diseases and Brain Tumors: Part II. DNA into their tears and develop recurrent herpetic-specific corneal lesions. Many different virus types have been explored for gene delivery, most commonly retrovirus, adenovirus, adeno-associated virus, and herpes simplex virus. Third, because cancer is fundamentally a genetic disease, gene-based therapy might be able to correct the genetic defects. One of the most promising viruses for sarcomas is herpes simplex virus. Our hope is to be able to test this virus in patients with sarcomas, though reaching that goal has so far proven elusive. Crippled, non-replicative viruses have been used as vectors to transfer genes into tumours.

Dna Transposon-based Gene Vehicles