The Herpes Simplex Virus Type 1 (HSV-1) US1 Gene Encodes Host-range And Ocular Virulence Determinants

Herpes simplex virus type 1 (HSV-1) causes recurrent mucocutaneous lesions, is an increasing cause of genital herpes, and is the primary source of infectious blindness and sporadic encephalitis in the United States 1 4. Several groups have used gene mapping methods to identify host genes influencing the severity of HSV-1 ocular disease. This study identified several virulence determinants, including UL41 (VHS), UL42 and US1 (ICP22), and suggested there was a complex interplay between viral genes since we obtained different disease phenotypes depending on which combinations of genes were transferred into the avirulent OD4 strain 6. The Herpes Simplex Virus 1 (HSV-1)-encoded ICP22 protein plays an important role in viral infection and affects expression of host cell genes. II and that ICP22 interacts directly with CDK9 to inhibit expression of host cell genes. Herpes simplex virus type 1 (HSV-1) is a neurotropic virus that establishes a lifelong latent infection within the sensory nerve ganglia of humans, after it has been acquired by infection of the oral mucosa or eye. The HSV-1 UL20 gene is highly conserved in alphaherpesviruses, e.g., varicella-zoster virus (4), bovine herpesvirus 1 (29), and pseudorabies virus (15), as well as in the gammaherpesvirus Marek’s disease virus type 2 (12). The UL20 open reading frame, which is positionally conserved among alphaherpesvirus genomes, encodes a 222-amino-acid nonglycosylated membrane protein and is regulated as a 1 gene. In the absence of the UL20 protein, virions are trapped in the perinuclear space, as well as in cytoplasmic vesicles of the host cell, and therefore, infectious virions are not released to the extracellular space.

The herpes simplex virus type 1 (HSV-1) US1 gene encodes host-range and ocular virulence determinants 2Herpes simplex virus type 1 (HSV-1) infection alters the phosphorylation of the large subunit of RNA polymerase II (RNAP II), resulting in the depletion of the hypophosphorylated and hyperphosphorylated forms of this polypeptide (known as IIa and IIo, respectively) and induction of a novel, alternatively phosphorylated form (designated IIi). DNA viruses regulate their genetic information during infection of host cells. Alternatively, HSV-1 may encode or induce additional factors which mediate changes to RNAP II. To determine whether d22-lacZ exhibits this host-range phenotype, single-cycle growth experiments were performed. Human herpes simplex viruses types 1 (HSV-1) and 2 (HSV-2), respectively, cause cold sores and genital lesions. FeHV-1 infection in cats is considered to be a good natural host model to study the comparative molecular pathogenesis of acute and latent alphaherpesvirus infections and to test novel immunization strategies. The size of FeHV-1 virions ranges from 120 to 180 nm. A better understanding of herpesvirus virulence factors is a prerequisite for the generation of safe and efficacious deletion mutant vaccines. Article: Using HSV-1 Genome Phylogenetics to Track Past Human Migrations.

Little is known about viral factors contributing to virulence, and there are currently only two genomic sequences available. A genome sequencer was used to sequence the HSV-1 ocular isolates TFT401, 134, CJ311, CJ360, CJ394, CJ970, and OD4, in a single lane. The herpes simplex virus type 1 (HSV-1) U(S)1 gene encodes host-range and ocular virulence determinants. Multiple determinants contribute to the virulence of HSV ocular and CNS infection and identification of serine 34 of the US1 gene as an ocular disease determinant. HSV displays a broad host cell range and its cellular receptors, heparan sulfate (HS), herpesvirus entry mediator (HVEM), and nectin-1 and 2, are widely expressed on the cell surface of numerous cell types. Almost half of the 84 known viral genes are nonessential for growth in tissue culture and then may be deleted to create genomic space for exogenous transgenes and to delete functions essential for virulence and toxicity in vivo. Attenuated, replication-competent herpes simplex virus type 1 mutant G207: safety evaluation of intracerebral injection in nonhuman primates. Herpes simplex virus type 1 (HSV-1) and herpes simplex virus type 2 (HSV-2) are two of the eight known viruses which comprise the human herpesvirus family. This results in considerable cross-reactivity between the HSV-1 and HSV-2 glycoproteins, although unique antigenic determinants exist for each virus.

Icp22 And The Ul13 Protein Kinase Are Both Required For Herpes Simplex Virus-induced Modification Of The Large Subunit Of Rna Polymerase Ii

The herpes simplex virus type 1 (HSV-1) US1 gene encodes host-range and ocular virulence determinants 3The HSV-1 virion ranges from 180 to 300 nm in diameter. Herpes simplex virus (HSV) type-1 and type-2 HSV entry Receptors. Unlike many herpesviruses, HSV has low species specificity and a wide host range. Combined analyses of the TK gene and genotype of sequential isolates showed that acyclovir-sensitive isolates contained multiple acyclovir-resistant variants of the same virus and that an identical acyclovir-resistant HSV-1 strain reappeared in the patient’s cornea during RHK episodes. Herpes simplex virus type 1 (HSV-1) is a highly prevalent human pathogen infecting 60 80 of the human population worldwide 1. The clinical variables scored were age, sex, history of ocular disease, therapy regimen, and clinical picture at presentation of each recurrence and at the end of follow-up. Detailed analyses of the clinical and laboratory data available did not provide insight into the viral and host factors predisposing to the enrichment and persistence of either acyclovir phenotype during consecutive HK episodes (data not shown). Characterization of an essential HSV-1 protein encoded by the UL25 gene reported to be involved in virus penetration and capsid assembly. Viral replication is required for induction of ocular immunopathology by herpes simplex virus. The herpes simplex virus virulence factor ICP34.5 and the cellular protein MyD116 complex with proliferating cell nuclear antigen through the 63-amino-acid domain conserved in ICP34. Isolation and characterization of herpes simplex virus type 1 host range mutants defective in viral DNA synthesis. Granulocytes in Ocular HSV-1 Infection: Opposing Roles of Mast Cells and Neutrophils. Most alphaherpesviruses e.g., herpes simplex virus HSV; varicella-zoster virus, VZV; and pseudorabies virus, PRV) invade the peripheral nervous system (PNS) in their natural hosts. Our a-herpesvirus of choice is PRV, a broad host range herpesvirus that causes fatal encephalitis in a wide variety of animal species except its natural host, the adult pig. CDNA analyses coupled with gene array technology are being developed to understand the role of virus and host genes in virus replications in various cell types and tissues of infected animals. Cyclooxygenase-1 and -2 are required for production of infectious pseudorabies virus.

Publications Authored By Aaron W Kolb

Several Other HSV-1 Mutants With Multiple Gene Deletions Have Been Created And Tested

Several other oncolytic viruses (Newcastle disease virus, reovirus, retrovirus, rabies virus) have not been extensively used in research and clinical therapy, due to small genome size, limited host range, unclear replication mechanisms, etc. HSV-1 mutants, and simultaneous delivery of multiple transgene and insertion of heterogonous promoters are allowed. Recently, there have been many reports about HSV-1 mutants. In several animal tumor models, HSV-1 mutants with TK gene deletion were created and tested for oncolytic virotherapy, which could induce tumor regression following intra-neoplastic administration 19. Herpes simplex virus type 1 has also been increasingly explored in cancer therapy. Herpes simplex virus type 1 mutants with TK gene deletion were created and tested for oncolytic virotherapy. Several other HSV-1 mutants with multiple gene deletions have been created and tested. They found that d106 showed more GFP transgene expression than other mutant strains.

Several other HSV-1 mutants with multiple gene deletions have been created and tested 2We identified two HSV-1 ICP27 amino-terminal deletion mutants with a similar release defect. The replication cycle of HSV-1 in cultured cells has been studied in detail. ICP27 also regulates the localization of two other IE proteins, ICP0 and ICP4 (1921). To test whether ICP27t2 can activate this gene, we carried out a cotransfection assay and found that it resembles ICP27 in its capacity to enhance gC protein expression (Fig. Many different classes of viruses appear to have been implicated in the lateral transfer of transposable elements during eukaryotic evolution 4, 6, 9 11 and together with the fact that a large variety of virus types continue to infect our cells, it is clear that a myriad of molecular mechanisms exist for the genetic modification of mammalian tissues. A sophisticated improved version was created a few years later in which a BAC containing the modified HSV-1 genome was further deleted for the essential gene encoding ICP27 and increased in size beyond the packaging limit of the virion by adding in extra copies of the ICP0 gene 28. We and others have since expanded the scope of this project to target cancers in the nervous system and elsewhere, using targeted or systemically delivered vectors derived from herpes simplex virus-1 (HSV-1). HSV-1 has many attractive features for development as an oncolytic and gene transfer vector. The essential and nonessential genes have been identified, and HSV genetic-engineering techniques have been developed (1). Development of a multiple deletion HSV-1 mutant.

The herpes simplex virus type 1 (HSV-1) mutant 1716 lacks both copies of the ICP34. Other oncolytic viruses based on HSV have also been developed and are in clinical trials, most notably OncoVex GM-CSF, developed by Amgen, which has successfully completed a pivotal Phase III trial for advanced melanoma. These molecules activate genetic anti-viral defence programs that protect cells from infection and prevent spread of the virus. Recombinant HSV-1 vectors have been constructed using homologous recombination techniques, which require time-consuming selection processes and structural confirmation. To test the ability of the CRISPR-Cas9 system to edit the genome of HSV1, thymidine kinase (TK) was targeted by the guide RNA vector gRNA-206 36. Oncolytic virotherapy with herpes simplex virus type 1 (HSV-1) is based on the virus’s ability to lyse tumor cells, without infecting and harming normal tissue. HSV-1 vector, dlsptk, contained a deletion for the TK gene in its genome. Since, many other vectors have been created to target different tumors, with varying efficacy and safety. Second generation multi-mutant HSV vectors became implemented to decrease the likelihood of a reversion in the virus to it’s infectious state.

Functional Comparison Of Herpes Simplex Virus 1 (HSV-1) And HSV-2 Icp27 Homologs Reveals A Role For Icp27 In Virion Release

The deletion of viral genes that, while essential for replication in normal tissue, were not required for replication in cancerous cells, allowed viruses to be retargeted toward cancer cells. Another HSV-1 mutant generated around the same time as hrR3, NV1020 (R7020), replaced five HSV-1 genes (UL55, encodes tegument protein (p)UL55;26 UL56, encodes envelope pUL56; and one copy each of repeat short (RS)1, encodes ICP4, RL1 and RL2, encodes ICP0) with the HSV-2 genomic region encoding several viral glycoproteins. While deletion mutants have been proven to greatly limit virus replication to cancer cells, the attenuation caused by deleting one or more genes limits viral effectiveness. Many different virus types have been explored for gene delivery, most commonly retrovirus, adenovirus, adeno-associated virus, and herpes simplex virus. Viruses containing this form of simple genetic deletions or mutations of viral genes to make them cancer selective are called type 1 viruses. One of the most promising viruses for sarcomas is herpes simplex virus. The most extensively studied Herpes Simplex Virus mutant is HSV1716, which was created by S. Moira Brown and is being tested by Crusade Laboratories in England. Established methods of DNA sequencing, genetic and forensic analysis all depend on the use of labelled oligonucleotides and/or deoxy- or dideoxy-nucleoside triphosphates, and require a DNA polymerization step. Hot-start PCR has been developed to alleviate primer dimer formation. The simultaneous analysis of multiple different STR loci enables a unique profile of an individual to be built up.

Oncolytic Virus

The Most Widely Studied System Uses The Thymidine Kinase Gene Of The Herpes Simplex Virus (HSVtk)

The most widely studied system uses the thymidine kinase gene of the Herpes simplex virus (HSVtk) 1

Conversion of Ganciclovir by HSV-TK and cellular kinase to Ganciclovir triphosphate. The most widely used suicide genes are Herpes Simplex Virus-1 Thymidine Kinase (HSV-TK), and Cytosine Deaminase (CD) from the virus Herpes simplex or the bacterium Escherichia coli respectively 6 7. So, they spread to neighboring cells by gap junction that mainly consists of connexin family of proteins among them connexin-43 is the most studied. Sequencing the thymidine kinase gene in Herpes simplex virus and Varicella zoster virus shows the rapid genetic variability and may facilitate the diagnosis of antiviral drug resistance. Retrovirus-mediated herpes simplex virus thymidine kinase gene therapy approach for hepatocellular carcinoma. (HSV-tk/GCV) system on hepatocellular carcinoma was studied in this experiment. Hepatocellular carcinoma (HCC) is one of the most common human malignancies, causing an estimated 1,250,000 death toll per year worldwide1. In this approach, a retrovirus-mediated gene transfer system is widely used with treatment of glioma including the clinical trial6,7.

The most widely studied system uses the thymidine kinase gene of the Herpes simplex virus (HSVtk) 2One such suicide gene, the thymidine kinase gene from the herpes simplex virus, in combination with the prodrug ganciclovir, has been extensively and successfully used in some animal models exhibiting a strong bystander effect. GCV is a better inhibitor of the growth of cells transfected with the HSV-tk gene than ACV, and, in particular, it is 10-fold more potent than ACV as an inhibitor of the growth of HSV-tk gene-transfected tumor cells (25). The most widely studied system uses the thymidine kinase gene of the Herpes simplex virus (HSVtk). The HSVtk gene confers sensitivity to the anti-herpes drug, ganciclovir (GCV), by phosphorylating GCV to a monophosphate form (GCV-MP). The purpose of the study was to explore the anti-tumor effect of ultrasound -targeted microbubble destruction mediated herpes simplex virus thymidine kinase (HSV-TK) suicide gene system on mice hepatoma. Suicide gene therapy has been widely used in liver cancer treatment and showed a good application prospect.

The herpes simplex virus thymidine kinase gene type 1 (HSV-Tk) ganciclovir (GCV) system is a novel therapeutic strategy for the modulation of graft-versus-host disease (GVHD), a major complication of allogeneic stem cell transplantation (allo-SCT). In this study we investigated the mechanisms of GCV resistance in a lymphoblastoid human T-cell line (CEM) transduced with the retroviral vector SFCMM3 containing the HSV-Tk gene. In the present study, we aimed to seek the best timing of GCV administration after MSCtk implantation under both in vitro and in vivo conditions. In the current study, we explore the use of a human papillomavirus (HPV) pseudovirion to deliver a herpes simplex virus thymidine kinase (HSV-tk) gene to ovarian tumor cells.

Bystander Effect In Herpes Simplex Virus-thymidine Cancer Gene Therapy: Role Of Gap-junctional Intercellular Communication1

The most widely studied system uses the thymidine kinase gene of the Herpes simplex virus (HSVtk) 3One of the most studied GDEPT systems is the herpes simplex virus thymidine kinase (HSV-TK) with purine nucleoside analog ganciclovir (GCV) as a prodrug. HSV-TK mutant (TK30) contains six amino acid substitutions and shows enhanced sensitivity to ganciclovir (Kokoris et al. Here, we describe some of the most commonly used antiglioma OV systems. Mutations in the thymidine kinase gene (tk) of herpes simplex virus type 1 (HSV-1) explain most cases of virus resistance to acyclovir (ACV) treatment. Here we report the detection of mutated HSV tk sequences in human ganglia. Acvr HSV clinical isolates from human mucocutaneous lesions have been studied extensively; however, Acvr HSV in the human nervous system has not been reported previously. Herpes simplex virus (HSV) thymidine kinase (TK) expression and the HSV TK gene have been evaluated in studies of gene control, as well as in animal and human studies of viral pathogenesis, including.

Blood Journal

Development And Optimization Of Herpes Simplex Virus Vectors For Multiple Long-Term Gene Delivery To The Peripheral Nervous System

Development and Optimization of Herpes Simplex Virus Vectors for Multiple Long-Term Gene Delivery to the Peripheral Nervous System. Herpes simplex virus (HSV) has often been suggested as a suitable vector for gene delivery to the peripheral nervous system as it naturally infects sensory nerve terminals before retrograde transport to the cell body in the spinal ganglia where latency. Several RNA viruses have also been developed for gene delivery, including a poliovirus replicon system for motor neurons. Herpes simplex virus (HSV) is an attractive candidate for use as a viral vector to express foreign genes. There has been some success on that front in peripheral neurons; however, long-term expression in the central nervous system has not been as good.

Development and Optimization of Herpes Simplex Virus Vectors for Multiple Long-Term Gene Delivery to the Peripheral Nervous System 2Virus vectors for gene delivery to the nervous system on ResearchGate, the professional network for scientists. Many developments in vectors should be occurring over the next few years that should increase the potential of these vectors for therapeutic gene delivery. Development and Optimization of Herpes Simplex Virus Vectors for Multiple Long-Term Gene Delivery to the Peripheral Nervous System. A number of studies have demonstrated transduction of DRG neurons using herpes simplex virus, adenovirus and more recently, adeno-associated virus (AAV). 6 as a gene transfer tool to target cellular mechanisms involved in the generation and development of chronic pain in mice. Palmer JA, Branston RH, Lilley CE, Robinson MJ, Groutsi F, Smith J, Latchman DS, Coffin RS: Development and optimization of herpes simplex virus vectors for multiple long-term gene delivery to the peripheral nervous system. Reduced immune responses after vaccination with a recombinant herpes simplex virus type 1 vector in the presence of antiviral immunity. 4e F4 ), the differentially pre-infected mice were only able to develop weak CTL responses KOS, 5; HSV-F, 55; T0-GFP, 13 (Fig. Development and optimization of herpes simplex virus vectors for multiple long-term gene delivery to the peripheral nervous system.

Our results support the utility of HSV vectors for gene silencing in peripheral neurons and the potential application of this technology to the study of nociceptive processes and in pain gene target validation studies. Lentiviruses, adenoassociated viruses and more recently, herpes simplex virus have been engineered to deliver short-hairpin RNA (shRNA) to parts of the nervous system (15 20,21). Development and optimization of herpes simplex virus vectors for multiple long-term gene delivery to the peripheral nervous system. Several issues must be considered in choosing a gene transfer vector for a spe- cific application. Figure 1 HSV vector-mediated gene delivery to the nervous system can be accom-. This paper reviews the major HSV-1 vector systems and analyses the common elements which These properties have yet to be determined for different viral vectors for human applications and gene delivery to different tissues by different methods of administration in animal models will need to be explored to translate this to clinical trials.

Virus Vectors For Gene Delivery To The Nervous System

Adeno-associated virus (AAV)-mediated gene delivery has emerged as an effective and safe tool for both preclinical and clinical studies of neurological disorders. Adeno-associated virus is a non-pathogenic dependovirus from the parvoviridae family requiring helper functions from other viruses, such as adenovirus or herpes simplex virus, to fulfill its life cycle (Dayton et al. To overcome these limitations, several methods have been developed to improve brain transduction after systemic injection (Figure 1). Samples were washed four times (10 min each) and developed with diaminobenzidine (Sigma, St. Louis, MO). Coffin RS: Development and optimization of herpes simplex virus vectors for multiple long-term gene delivery to the peripheral nervous system.

Efficient Delivery Of Rna Interference To Peripheral Neurons In Vivo Using Herpes Simplex Virus

(D) HSV-2 DNA (qPCR, UL30 Gene) In Genital Tract And Neural Tissue Samples At Day 5 Post-virus Inoculation

(D) HSV-2 DNA (qPCR, UL30 gene) in genital tract and neural tissue samples at day 5 post-virus inoculation. The Ct cut off was determined with HSV-uninfected na ve samples. In addition, HSV DNA (US6 gene) was not detected by qPCR in vaccinated mice (limit of detection 3 HSV-2 genome copies), but was detected in all controls (Figure 3H). (D) HSV-2 DNA (qPCR, UL30 gene) in genital tract and neural tissue samples at day 5 post-virus inoculation. The Ct cut off was determined with HSV-uninfected na ve samples.

The Herpes Virus Manipulates Our DNA To Replicate: What Those Infected Can Do About It 2After the initial or primary infection, some infected people experience sporadic episodes of viral reactivation or outbreaks. Herpes simplex virus (HSV)-2 is periodically shed in the human genital tract, most often asymptomatically, and most sexual transmissions occur during asymptomatic shedding. Importantly, no challenge wild-type HSV-2 viral DNA was detectable in dorsal root ganglia DNA isolated from CJ2-gD2-immunized guinea pigs on day 60 post-challenge. A Herpes Simplex Virus 2 (HSV-2) Glycoprotein D-expressing Nonreplicating Dominant-Negative HSV-2 Virus Vaccine Is Superior to a gD2 Subunit Vaccine against HSV-2 Genital Infection in Guinea Pigs. Vaginal swabs were taken on days 1, 2, 3, 5, 7, and 9 post-infection. Although PCR has been the diagnostic standard method for HSV infections of the central nervous system, until now viral culture has been the test of choice for HSV genital infection.

Although HSV-2 is the leading cause of genital ulcer disease worldwide (5, 6), most people are not aware of the infection (7), and may transmit the virus during periods of subclinical shedding (8, 9). Studies that measure the frequency of viral shedding and the quantity of virus detected from the genital tract have provided insight into the natural history and pathogenesis of HSV-2 infection. Cytoplasmic DNA sensors, such as stimulator of IFN genes (STING), mediate production of IFN in response to HSV infection, as demonstrated in cell culture and in knockout mouse models (58). To date, no vaccine that is safe and effective against herpes simplex virus 2 (HSV-2) disease has been licensed. (UL5) and DNA polymerase (UL30) genes or the single-stranded DNA binding protein (UL29) and primase (UL52) genes. To confirm vaginal viral replication and measure shedding, vaginal swab samples were collected on days 1, 3, 5, 7, 9, and 12 postchallenge using 15-cm polyester-tipped swabs (catalog no. This enhancement was detected as early as Day 1 after infection in LPL whereas it could only be detected in PBML 8 days after infection.

Herpes Simplex Virus

Sample records for promotes episomal replication. 1; 2; 3; 4; 5; LANA mediates viral DNA replication and segregates episomes to daughter nuclei. Herpesviruses establish latency in suitable cells of the host organism after a primary lytic infection. This highly efficient genetic system facilitates high-throughput functional characterization of algal genes and accelerates molecular phytoplankton research.

Promotes Episomal Replication: Topics By

Keywords: HSV, Viral Vectors, Oncolytic Vectors, Gene Therapy, Neurodegenerative Disorders, Cancer, Targeting, Vaccines

Selective oncolysis in combination with modulation of the immune response mediated by replication-conditional HSV-1 vectors appears to be a highly promising approach in the battle against malignant glioma. PNS and CNS for the treatment of various neurodegenerative disorders or chronic pain. Replication-defective herpes simplex virus vectors for gene transfer in vivo. However, numerous delivery challenges must be overcome to extend this success to many diseases; these challenges include developing techniques to evade preexisting immunity, to ensure more efficient transduction of therapeutically relevant cell types, to target delivery, and to ensure genomic maintenance. Fortunately, vector-engineering efforts are demonstrating promise in the development of next-generation gene therapy vectors that can overcome these barriers. Key words:viral vectors – HSV-1-based amplicons – applications – technological improvements. Viral-derived vectors are the most promising gene transfer tools due to the fact that viruses are naturally occurring molecular devices that have evolved to ensure targeted gene delivery and efficient expression in most cell types. Recombinant attenuated viruses are replication-competent HSV-1 vectors carrying mutations that restrict spread and lytic viral replication to cancer cells without causing major toxicity to the healthy tissues. A few studies have addressed the use of amplicons for gene therapy of neurodegenerative disorders, such as treatment of experimental models of Parkinson’s disease, or inherited genetic diseases affecting the nervous system such as ataxia-telangiectasia and Friedreich’s ataxia.

Keywords: HSV, viral vectors, oncolytic vectors, gene therapy, neurodegenerative disorders, cancer, targeting, vaccines 2Keywords: epigenetics, glioma, oncolytic virus, HDAC inhibitor, HSV-1, cancer. In contrast to non-replicating viral vectors, OVs still maintain most of their viral genes intact, particularly those that encode genes required for the viral replicative life cycle, viral evasion mechanisms from host defense, and immune surveillance. Inhibitors of zinc-dependent HDACs have shown great potential in the treatment of epigenetic disorders including cancers. Research Keywords: Human tumor virology (KSHV, MCV and digital transcriptome subtraction). Dendritic cell dynamics in viral infections; vector-based vaccines for viral infections. Gene therapy for brain tumors using HSV-based vectors; molecular targeting to tumor cells; molecular mechanisms of tumor cell migration; miRNAs in cancer progression. HSV; VZV; herpes simplex virus; zoster; varicella; viral infection; viral latency; infectious eye disease; pain and post-herpetic neuralgia; neuronal infection. Keywords: Molecular analysis; Radiology and radiologists, research; Review. (disease-resistant crops, biologically derived pesticides, vaccines), among others.

Viral vectors have provided excellent delivery and high expression of heterologous genes. Similarly, helper-free HSV-1 vectors expressing GDNF and BDNF were evaluated in a rat model for Parkinson s disease 7. Further development has included using oncolytic SFV vectors against lung cancer 26 and osteosarcoma 27 in mouse models. Partridge WM (2004) Intravenous, non-viral RNAi gene therapy of brain cancer. Helper-dependent herpes simplex virus (HSV) vectors (amplicons) show considerable promise to provide for long-term transduced-gene expression in most cell types. HSV-specific primers were targeted to the UL40 gene (primer 40 ACCATAGCCAATCCATGACC ) and theUL42 gene (primer 42 GTCGTGAGGAAGAACTTGAGG ) and were designed to amplify across the entire UL41 gene. The development of gene-based therapies is currently being pursued in fields as diverse as infectious disease, autoimmune disease, cardiovascular disease, and neurodegenerative disease.

Combining Hdac Inhibitors With Oncolytic Virotherapy For Cancer Therap

Keywords: HSV, viral vectors, oncolytic vectors, gene therapy, neurodegenerative disorders, cancer, targeting, vaccines 3

Alphavirus Vectors For Therapy Of Neurological Open Access

Herpes Simplex Virus (HSV) Is A Neurotropic DNA Virus With Many Favorable Properties As A Gene Delivery Vector

Herpes simplex virus (HSV) is a neurotropic DNA virus with many favorable properties as a gene delivery vector. HSV is highly infectious, so HSV vectors are efficient vehicles for the delivery of exogenous genetic material to cells. Herpes simplex virus type 1 (HSV-1) is a neurotropic double-stranded DNA virus that causes cold sores, keratitis, and rarely encephalitis in humans. These findings demonstrate the importance of understanding basic virology in the design of vector systems and the powerful approach of exploiting favorable properties of the parent virus in the generation of gene transfer vectors. HSV-1 is a large double-stranded DNA virus that can accommodate large or multiple transgene cassettes and replication-defective viruses can be constructed for gene delivery without vector-associated toxicity. Herpes simplex virus type 1 (HSV-1) is a neurotropic DNA virus with many favorable properties both as a delivery vector for cancer therapeutic genes and as a backbone for oncolytic viruses.

Herpes simplex virus (HSV) is a neurotropic DNA virus with many favorable properties as a gene delivery vector 2Herpes simplex virus type 1 (HSV-1) is a neurotropic DNA virus with many favorable properties both as a delivery vector for cancer therapeutic genes and as a backbone for oncolytic viruses. Gene therapy utilizes the delivery of DNA into cells, which can be accomplished by several methods, summarized below. Lysogenic viruses integrate their DNA into the DNA of the host cell and may live in the body for many years before responding to a trigger. The Herpes simplex virus is a human neurotropic virus. 4 Caution for rare cases of encephalitis must be taken and this provides some rationale to using HSV-2 as a viral vector as it generally has tropism for neuronal cells innervating the urogenital area of the body and could then spare the host of severe pathology in the brain. DNA vectors possess several valuable advantages over viral vectors, such as easy scale-up production, amenable to carrying large genes, and lack of any viral component, hence low immunotoxicity. Gammaretrovirus can only transduce replicating cells, whereas lentivirus can also transduce non-replicating cells, which makes lentiviral vector more favorable in many gene therapy settings (Sakuma et al. Therefore, great efforts have been focused on developing AAV capsids that have unique characteristics. HSV is a naturally neurotropic virus.

Herpes simplex virus type 1 (HSV-1) has properties that can be exploited for the development of gene therapy vectors. The neurotropism of HSV enables delivery of therapeutic genes to the nervous system. Replicating HSV-LIF and its DNA were detected in the CNS during the acute infection, and the vector spread to the spinal cord but was non-virulent. The HSV-LIF vector induced favorable changes in the mRNA levels of Th17 and Treg cytokines. DNA. TYPE. Non-Viral Vector. TARGET. Naked DNA is not specific for any cell type. Several gene therapy successes use ex vivo gene delivery as an alternative to bone marrow transplants. Analysis of the best animal models for testing enzymes for HBV, HSV, HIV and HPV.

Herpes Simplex Virus 1 (HSV-1) For Cancer Treatment

Adeno-Associated Viruses: Enhanced In Vivo Gene Delivery. The most commonly used viral vectors in studies of treatment of pain are based on recombinant adenovirus (AD), adeno-associated virus (AAV), lentiviral (LV) vectors, and herpes simplex virus (HSV)-based vectors 2,3, especially AAV and HSV. The HSV-1 viral vector strategy carrying the gene for pro-enkephalin has been widely shown pre-clinically to reverse manifestations of chronic pain in models of inflammation 5, pancreatitis 6, spinal nerve 7 and infraorbital 8 nerve ligation, and bone cancer 9. For example, intraspinal delivery of rAAV2 carrying the gene for BDNF resulted in reversal of neuropathic pain behaviors induced by chronic constriction injury 23. Two well-studied suicide gene therapies are the herpes simplex virus (HSV) type 1 thymidine kinase (tk)/ganciclovir (GCV) system (HSV-tk/GCV) and the cytosine deaminase (CD)/5-fluorocytosine (5-FC) system (CD/5-FC). By utilizing the tumor-tropic properties of mesenchymal stem cells, HSV-tk expressing MSCs can migrate to glioma tissue and exert enhanced antitumor activity. Apart from targeting the neoplastic cells directly, another strategy is introducing genes that may alter the tumor stroma in order to create unfavorable conditions for tumor growth or enhance the efficacy of therapy. While viruses are the most efficient vectors for delivering a therapeutic gene to tumor cells, oncolytic virotherapy itself can also be considered a mode of gene therapy for treating GBM (Fig.

Plos One: A Herpes Simplex Virus-derived Replicative Vector Expressing Lif Limits Experimental Demyelinating Disease And Modulates Autoimmunity

Gene Defect In Margarita Islanders May Protect Against Herpes Infection By Christina A

IFN activity against herpes simplex virus-1 (HSV-1) in keratinocytes (25). Thus, endogenous SOCS may help control cells like macrophage, microglia, or dendritic cells in the CNS, while the infiltrating effector T cells, not dependent on the accessory cells (36), may be little affected due to the absence of endogenous SOCS1 and/or SOCS3. Thus, the SOCS1 antagonist inhibited vaccinia virus replication and not simply its release, the latter being less reliable in protecting infected mice. Molecular tools such as gene transfections and siRNA have played a major role in our functional understanding of the SOCS proteins where a key functional domain of 12 amino acid residues called the kinase inhibitory region (KIR) has been identified on SOCS1 and SOCS3. The antagonist enhanced innate and adaptive immune response against a broad range of viruses including herpes simplex virus, vaccinia virus, and an EMC picornavirus. A SOCS1/3 Antagonist Peptide Protects Mice Against Lethal Infection with Influenza A Virus. Photodynamic therapy-generated vaccines prevent tumor recurrence after radiotherapy.

Gene defect in Margarita islanders may protect against herpes infection By Christina A 2Kakourou, Georgia; Vrettou, Christina; Kattamis, Antonis; Destouni, Aspasia; The infection vulva vaginitis, caused by candida, may require medical attention. Original Article from The New England Journal of Medicine Incidence of Early Loss of Pregnancy.

Seroepidemiology of cytomegalovirus infection in pregnant women in Durango City, Mexico. Submicroscopic deletion of 5q involving tumor suppressor genes (CTNNA1, HSPA9) and copy neutral loss of heterozygosity associated with TET2 and EZH2 mutations in a case of MDS with normal chromosome and FISH results. Lack of association between Toxoplasma gondii infection and hypertensive disorders in pregnancy: a case-control study in a Northern Mexican population. Knowledge and acceptance of vaccine against human papillomavirus among mothers of students from Durango city, Mexico.

Preimplantation Hla Typing: Topics By

Frontiers

Human Herpes Simplex Virus (HSV) Is A Contagious Infection With A Large Reservoir In The Gene

They are known as the human herpesviruses and are herpes simplex virus type 1, herpes simplex virus type 2, varicella-zoster virus, cytomegalovirus, Epstein-Barr virus, human herpesvirus 6, human herpesvirus 7 and, most recently, Kaposi’s Sarcoma herpesvirus. Herpesviruses have a unique four-layered structure: a core containing the large, double-stranded DNA genome is enclosed by an icosapentahedral capsid which is composed of capsomers. Genes are replicated in a specific order: (1) immediate-early genes, which encode regulatory proteins; (2) early genes, which encode enzymes for replicating viral DNA; and (3) late genes, which encode structural proteins. The reservoir for the disease is latent infection in rhesus monkeys, particularly those from Southeast Asia and India. Herpes simplex virus 1 and 2 also known as human herpesvirus 1 and 2 are two members of the herpesvirus family, Herpesviridae, that infect humans. Both HSV-1 (which produces most cold sores) and HSV-2 (which produces most genital herpes) are ubiquitous and contagious. Symptoms of herpes simplex virus infection include watery blisters in the skin or mucous membranes of the mouth, lips or genitals. Herpes virus include Chicken-pox virus and Herpes simplex viruses (HSV-1, HSV-2), all of which establish episomal latency in neurons and leave linear genetic material floating in the cytoplasm.

Human herpes simplex virus (HSV) is a contagious infection with a large reservoir in the gene 2In vitro-transformed cells and tumors should express the same viral gene products. An increase in IgG and IgM titer in the sera of a large number of CFS patients (119 of 154) was found relative to that in the control population (77 vs. Her research on herpes simplex virus 1 deals primarily with mechanisms of virus entry into the cells and identification of cellular receptors for entry and the mechanisms of HSV transport and exit through the exocytic pathway. Herpes simplex virus type 1 (HSV-1) and herpes simplex virus type 2 (HSV-2) are two of the eight known viruses which comprise the human herpesvirus family. As with all herpesviruses, they are large, enveloped virions with an icosahedral nucleocapsid consisting of 162 capsomeres, arranged around a linear, double-stranded DNA core. Animal vectors for human HSV infections have not been described, and humans remain the sole reservoir for transmission to other humans. 2003), is the macaque counterpart of herpes simplex virus (HSV) in humans.

Human herpes simplex virus (HSV) is a contagious infection with a large reservoir in the general population. It has a potential for significant complications in the immunocompromised host. Latent Infection: Virus remains in a cell and does not replicate, as in HSV, VZV, CMV, EBV, and HIV. Early Genes are transcribed by host cell RNA-Polymerase, to form early proteins. HERPES SIMPLEX 1 (HHV-1, HSV-1): Infection usually occurs early in childhood, and in some communities more than 90 seroconversion is seen by age 10. MONKEYPOX VIRUS: Not widespread or contagious like human smallpox. Herpes 411. The overall HSV-2 seroprevalence was 47.3 (375/793), 45.5 (187/411) in 2008 and 50.1 (206/411) in 2009. Human herpes simplex virus (HSV) is a contagious infection with a large reservoir in the gene. This is a guide about remedies for cold sores.

Human Herpesvirus 6: An Emerging Pathogen

Human herpes simplex virus (HSV) is a contagious infection with a large reservoir in the gene 3When a virus enters a host cell, the viral genes redirect the genetic and metabolic activities of the host cell. Herpes whitlow is a deep set herpes simplex virus infection of the: A. Human herpesvirus 6 (HHV-6) has the following characteristics, except: A. D. includes large cauliflower-like masses called condylomata acuminata E. Symptoms of herpes simplex virus infection include watery blisters in the skin or mucous membranes of the mouth, lips or genitals. The structure of herpes viruses consists of a relatively large double-stranded, linear DNA genome encased within an icosahedral protein cage called the capsid, which is wrapped in a lipid bilayer called the envelope. By maintaining the host cells, LAT expression preserves a reservoir of the virus, which allows subsequent, usually symptomatic, periodic recurrences or outbreaks characteristic of non-latency. Elements surrounding the gene for ICP4 bind a protein known as the human neuronal protein Neuronal Restrictive Silencing Factor (NRSF) or human Repressor Element Silencing Transcription Factor (REST). Herpes simplex virus type-1 (HSV-1) establishes a life-long latent infection in peripheral neurons. This latent reservoir is the source of recurrent reactivation events that ensure transmission and contribute to clinical disease. Single cell codetection of a gene, its RNA product and cellular regulatory proteins is critical to study gene expression regulation. RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. Genetic Characterization of Herpes Simplex Virus Type 2 UL23 Thymidine Kinase in Johannesburg, South Africa. Similarity of Triplex Capsid Protein of Human Herpes Simplex Virus. Symptoms of herpes simplex virus infection include watery blisters in the skin or mucous membranes of the mouth, lips or genitals. Scientific and Academic News for Detection herpes simplex virus. Genes and Genetics News. Read today’s medical research in genetics including what can damage genes, what can protect them, and more. Adamantane resistance in circulating human influenza A viruses from Alberta, Canada (1970 2007) by Kanti Pabbaraju; Kevin C.

Herpes Simplex

Herpes Simplex Viruses (HSV) Have Utility For Gene Transfer Into Nerves And As Oncolytic Agents

Herpes simplex viruses (HSV) have utility for gene transfer into nerves and as oncolytic agents. We studied the use of an attenuated HSV, NV1023, as treatment for cancers with neural invasion. Neoadjuvant treatment of hepatic malignancy: an oncolytic herpes simplex virus expressing IL-12 effectively treats the parent tumor and protects against recurrence-after resection. The objective of the study was to evaluate the utility of NV1042, a replication competent, oncolytic herpes simplex virus (HSV) containing the interleukin-12 (IL-12) gene, as primary treatment for hepatic tumors and to further assess its ability to reduce tumor recurrence following resection. In addition to their efficacy as gene transfer agents, attenuated herpes viruses have potent antitumor activity by direct oncolysis. Unlike HSV vectors used solely for gene transfer, oncolytic HSV are replication competent although modified by deletion of certain strategic viral growth genes. Herpes simplex virus (HSV) possesses several unique properties as an oncolytic agent (2). The use of a replication-conditional strain of HSV-1 as an oncolytic agent was first reported for the treatment of malignant gliomas (29). There have been several studies focusing on developing regulatable replication-conditional virus or oncolytic virus for tumor therapy. Given that gene expression can be regulated in a highly sensitive manner following infection of cells with the T-REx-encoding replication-defective virus both in vitro and in vivo, we set out to explore the utility of T-REx gene switch technology in construction of a regulatable oncolytic HSV recombinant whose replication can be stringently controlled by tetracycline.

Herpes simplex viruses (HSV) have utility for gene transfer into nerves and as oncolytic agents 2It has been a long-held belief that viruses used for delivery of genes into human cells for therapeutic purposes should be rendered incapable of replication based on concerns that viral replication Unlike intralesion inoculation, intravascular administration of hrR3 targets widespread disease; therefore, HSV1 mutants engineered to restrict productive infection to tumor cells hold promise as cancer therapeutic agents. Curcumin, a potential chemopreventive agent, was found to inhibit cancer cells in S/G2M phases of the cell cycle, when radiation is more effective. Nerve-sparing Therapy with Oncolytic Herpes Virus for Cancers with Neural Invasion. Herpes simplex viruses (HSV) have utility for gene transfer into nerves and as oncolytic agents. The present invention relates to clinical herpes simplex virus (HSV) isolates with improved oncolytic capabilities as compared to reference laboratory HSV strains. Ii. inserting said gene into said HSV1 strain; and. HSV and other viruses such as adeno- or rheovirus also have potential utility in the oncolytic treatment of cancer. (i) inoculating into a cell of the central nervous system with a replication incompetent herpes virus of the invention; and.

Herpes simplex virus-1 (HSV-1) is a relatively large double-stranded DNA virus encoding at least 89 proteins with well characterized disease pathology. In replacement gene therapy, replication-defective viruses have been utilized as delivery vectors. Oncolytic herpes simplex virus (HSV1716), lacking the neurovirulence factor ICP34. 5, has highly selective replication competence for cancer cells and has been used in clinical studies of glioma, melanoma, head and neck squamous cell carcinoma, pediatric non-central nervous system solid tumors,. Combination studies with oncolytic HSV1716 virus and chemotherapy and targeted agents As oncolytic viruses gain acceptance as potential therapeutics their interactions with other cancer drugs need to be investigated. HSV-1 has several potential advantages as a vector to transfer genes into the CNS. Replication-defective recombinant vectors are non-toxic gene transfer tools that preserve most of the neurotropic features of wild type HSV-1, particularly the ability to express genes after having established latent infections, and are thus proficient candidates for therapeutic gene transfer settings in neurons. Herpes simplex virus (HSV) is an enveloped, double-stranded (ds) DNA virus 1. Entry of HSV into cells involves interactions between the viral receptor-binding protein gD and the gD receptors. Replication-competent HSV vectors have been used mainly as oncolytic therapeutic agents.

An Oncolytic Herpes Simplex Virus Type 1 Selectively Destroys Diffuse Liver Metastases From Colon Carcinoma

Gene therapy vectors can be categorized into two classes: Artificial non-viral vectors and viral vectors. HSV vectors have proven to be exceptionally efficient oncolytic agents. Oncolytic virotherapy with herpes simplex virus type 1 (HSV-1) is based on the ability of an attenuated virus to destroy the infected tumor cells 3 5. Background: Reovirus is a naturally occurring oncolytic virus that usurps activated Ras-signaling pathways of tumor cells for its replication. Importantly, for highly invasive gliomas, there was no tumor invasion into underlying muscle in any animals treated with live virus. Virally mediated direct oncolysis may overcome the difficulties of low rates of infection and gene transfer that have plagued virus-mediated gene transfer approaches in glioma patients (29). Combination of Virotherapy and T-cell Therapy: Arming Oncolytic Virus with T-cell Engagers. Abstract: While cure rates for several cancers have significantly improved, the outcome for patients with advanced solid tumors remains grimly unchanged over the last decades. As cell-based gene therapy blossomed, we also summarized the diverse types of cells and vectors employed in ex vivo gene transfer. Recently, the utility of siRNAs as a microbicide, usually applied to the genital mucosa for preventing transmission of sexually transmitted diseases including HIV-1 and HSV-2, has been investigated. Viruses have demonstrated strong potential for the therapeutic targeting of glioblastoma stem cells (GSCs). OV, either naturally occurring or developed through genetic engineering, are being investigated as oncolytic agents for cancer treatment due to their ability to specifically infect and lyse neoplastic cells while sparing normal cells 14, 15, 16, 17. For example, adenoviruses armed with immune-therapeutic genes such as IL-12 and IL-24 have shown some efficacy in preclinical studies for the treatment of prostate cancers 16,33. Herpes simplex virus type I (HSV-1) is a natural human pathogen which has been studied as an oncolytic agent for over two decades. The integration of membrane-fusion activity into these viruses has been shown to promote anti-tumor effects in prostate cancer cells 29,49. NDV as an oncolytic agent for the treatment of prostate cancer is currently in the early stages of development.

Friendly Fire: Redirecting Herpes Simplex Virus-1 For Therapeutic Applications

Cell-External Factors: Virus Entry and Receptor Interaction.